Review



forward m13-f primer  (Promega)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Promega forward m13-f primer
    Forward M13 F Primer, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/forward+m13-f+primer/forward+m13+f+primer/pmc04429320-52-27-37
    Average 90 stars, based on 1 article reviews
    forward m13-f primer - by Bioz Stars, 2026-10
    90/100 stars

    Images

    Related Articles

    Generated:

    Article Title: Key patterning genes contribute to leg elongation in water striders
    Article Snippet: For each gene, the template was generated by PCR using the following primers containing T7 promoter sequence which is depicted in lower case letters: dpp : forward M13-F primer positioned upstream of T7 promoter in pGEM-T vector (Promega, Madison, WI, USA) and reverse 5′-taatacgactcactatagggagaccacCTATGGCGGGCATGACATCCAAACT-3′; wg : forward 5′-taatacgactcactatagggagaccacCGGCATTCATMTATGCRATAACCAG-3′ and reverse 5′-taatacgactcactatagggagaccacTTGTATCCCTAGGCTCGGGTTGCGTT-3; hh : forward 5′-taatacgactcactatagggagaccacAAGACGAMGARGGCAGAGGWGCCGAT-3′ and reverse 5′-taatacgactcactatagggagaccacTARTWGACCCAATCGAAWCCGGCTTC-3; egfr : forward 5′-taatacgactcactatagggagaccacAAACGCACTTGCCAACGACTCAGAGTT-3′ and reverse 5′-taatacgactcactatagggagaccacAGTGGTAGGGTTGTATCGCTGCATTG-3.

    Polymerase Chain Reaction:

    Article Title: Key patterning genes contribute to leg elongation in water striders
    Article Snippet: For each gene, the template was generated by PCR using the following primers containing T7 promoter sequence which is depicted in lower case letters: dpp : forward M13-F primer positioned upstream of T7 promoter in pGEM-T vector (Promega, Madison, WI, USA) and reverse 5′-taatacgactcactatagggagaccacCTATGGCGGGCATGACATCCAAACT-3′; wg : forward 5′-taatacgactcactatagggagaccacCGGCATTCATMTATGCRATAACCAG-3′ and reverse 5′-taatacgactcactatagggagaccacTTGTATCCCTAGGCTCGGGTTGCGTT-3; hh : forward 5′-taatacgactcactatagggagaccacAAGACGAMGARGGCAGAGGWGCCGAT-3′ and reverse 5′-taatacgactcactatagggagaccacTARTWGACCCAATCGAAWCCGGCTTC-3; egfr : forward 5′-taatacgactcactatagggagaccacAAACGCACTTGCCAACGACTCAGAGTT-3′ and reverse 5′-taatacgactcactatagggagaccacAGTGGTAGGGTTGTATCGCTGCATTG-3.

    Sequencing:

    Article Title: Key patterning genes contribute to leg elongation in water striders
    Article Snippet: For each gene, the template was generated by PCR using the following primers containing T7 promoter sequence which is depicted in lower case letters: dpp : forward M13-F primer positioned upstream of T7 promoter in pGEM-T vector (Promega, Madison, WI, USA) and reverse 5′-taatacgactcactatagggagaccacCTATGGCGGGCATGACATCCAAACT-3′; wg : forward 5′-taatacgactcactatagggagaccacCGGCATTCATMTATGCRATAACCAG-3′ and reverse 5′-taatacgactcactatagggagaccacTTGTATCCCTAGGCTCGGGTTGCGTT-3; hh : forward 5′-taatacgactcactatagggagaccacAAGACGAMGARGGCAGAGGWGCCGAT-3′ and reverse 5′-taatacgactcactatagggagaccacTARTWGACCCAATCGAAWCCGGCTTC-3; egfr : forward 5′-taatacgactcactatagggagaccacAAACGCACTTGCCAACGACTCAGAGTT-3′ and reverse 5′-taatacgactcactatagggagaccacAGTGGTAGGGTTGTATCGCTGCATTG-3.

    Plasmid Preparation:

    Article Title: Key patterning genes contribute to leg elongation in water striders
    Article Snippet: For each gene, the template was generated by PCR using the following primers containing T7 promoter sequence which is depicted in lower case letters: dpp : forward M13-F primer positioned upstream of T7 promoter in pGEM-T vector (Promega, Madison, WI, USA) and reverse 5′-taatacgactcactatagggagaccacCTATGGCGGGCATGACATCCAAACT-3′; wg : forward 5′-taatacgactcactatagggagaccacCGGCATTCATMTATGCRATAACCAG-3′ and reverse 5′-taatacgactcactatagggagaccacTTGTATCCCTAGGCTCGGGTTGCGTT-3; hh : forward 5′-taatacgactcactatagggagaccacAAGACGAMGARGGCAGAGGWGCCGAT-3′ and reverse 5′-taatacgactcactatagggagaccacTARTWGACCCAATCGAAWCCGGCTTC-3; egfr : forward 5′-taatacgactcactatagggagaccacAAACGCACTTGCCAACGACTCAGAGTT-3′ and reverse 5′-taatacgactcactatagggagaccacAGTGGTAGGGTTGTATCGCTGCATTG-3.



    Similar Products

    m13 forward/reverse (m13 f/r) primer  (Bioneer Corporation)
    90
    Bioneer Corporation m13 forward/reverse (m13 f/r) primer
    M13 Forward/Reverse (M13 F/R) Primer, supplied by Bioneer Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/forward+m13-f+primer/universal+m13+primer/pm30243384-48-7-12
    Average 90 stars, based on 1 article reviews
    m13 forward/reverse (m13 f/r) primer - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    forward m13-f primer  (Promega)
    90
    Promega forward m13-f primer
    Forward M13 F Primer, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/forward+m13-f+primer/forward+m13+f+primer/pmc04429320-52-27-37
    Average 90 stars, based on 1 article reviews
    forward m13-f primer - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    forward and reverse m13 primers (f: 50 gttttcccagtcacgacgttg 30 and r: 50 tg agcggataacaatttcacacag 30)  (SibEnzyme ltd)
    90
    SibEnzyme ltd forward and reverse m13 primers (f: 50 gttttcccagtcacgacgttg 30 and r: 50 tg agcggataacaatttcacacag 30)
    Forward And Reverse M13 Primers (F: 50 Gttttcccagtcacgacgttg 30 And R: 50 Tg Agcggataacaatttcacacag 30), supplied by SibEnzyme ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/forward+m13-f+primer/forward+and+reverse+m13+primers++f++50+gttttcccagtcacgacgttg+30+and+r++50+tg+agcggataacaatttcacacag+30+/pm21476042-76-15-34
    Average 90 stars, based on 1 article reviews
    forward and reverse m13 primers (f: 50 gttttcccagtcacgacgttg 30 and r: 50 tg agcggataacaatttcacacag 30) - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    m13 forward (f) sequencing primer  (Schuelke)
    90
    Schuelke m13 forward (f) sequencing primer
    M13 Forward (F) Sequencing Primer, supplied by Schuelke, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/forward+m13-f+primer/m13+primer/pm15690173-95-24-16
    Average 90 stars, based on 1 article reviews
    m13 forward (f) sequencing primer - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier

    Image Search Results